Age-Associated Loss of Lamin-B Leads to Systemic Inflammation and Gut Hyperplasia

SummaryAging of immune organs, termed as immunosenescence, is suspected to promote systemic inflammation and age-associated disease. The cause of immunosenescence and how it promotes disease, however, has remained unclear. We report that the Drosophila fat body, a major immune organ, undergoes immunosenescence and mounts strong systemic inflammation that leads to deregulation of immune deficiency (IMD) signaling in the midgut of old animals. Inflamed old fat bodies secrete circulating peptidoglycan recognition proteins that repress IMD activity in the midgut, thereby promoting gut hyperplasia. Further, fat body immunosenecence is caused by age-associated lamin-B reduction specifically in fat body cells, which then contributes to heterochromatin loss and derepression of genes involved in immune responses. As lamin-associated heterochromatin domains are enriched for genes involved in immune response in both Drosophila and mammalian cells, our findings may provide insights into the cause and consequence of immunosenescence during mammalian aging.PaperFlic

Targeting mdr1 and endocrine therapy-­resistant cancers through estrogen receptor

Estrogens, acting via estrogen receptor (ER), stimulate cell proliferation and are associated with the development of aggressive breast and ovarian cancers. Endoplasmic reticulum (EnR) stress signaling cascade, the unfolded protein response (UPR), has documented in various human cancers and diseases. However, the precise roles of UPR signaling in development of hormone-dependent gynecological cancers were unknown. Here we show that the activation of UPR prior to EnR stress, also known as the anticipatory UPR activation, is a new paradigm for estrogen-ER action. We found that 17-estradiol (E2), acting through ER, rapidly activates Phospholipase C (PLC) leading to the production of inositol triphosphate (IP3). The IP3 binds to and opens endoplasmic reticulum (EnR) IP3 receptors (IP3R) leading to extremely rapid (<1 min.) efflux of calcium (Ca2+) from the lumen of the EnR into the cell body. Elevated intracellular Ca2+ primes cells for subsequent actions of E2-ER; depletion of EnR Ca2+ activates the unfolded protein response (UPR), inducing the important chaperone BiP/GRP78 (glucose-regulated protein 78 kDa). Activation of this pathway is required for E2-ER-regulated gene expression, cell proliferation and protects cells against stress. We target this pathway with our medically promising ER biomodulator, BHPI, which uses the same pathway as E2, but induces toxic hyperactivation of the anticipatory UPR, shifting it from protective to cytotoxic. As a result, at nanomolar concentration, BHPI blocked growth and often killed diverse therapy-resistant and ER-positive breast, ovarian, and endometrial cancer cells. Moreover, in a mouse xenograft, BHPI treatment resulted in rapid and substantial regression of pre-existing tumors. Extending the novel action of BHPI by hyperactivating anticipatory UPR, a new approach to inactivating multidrug resistance protein 1 (MDR1) in therapy resistant breast and ovarian cancer cells was developed. To evaluate the effectiveness of BHPI in reversing multidrug resistance in vivo, multidrug resistant OVCAR-3 ovarian cells, that are resistant to all known anticancer agents, were used in an orthotopic mouse tumor model. This study demonstrated that BHPI in combination with the taxane, paclitaxel, reduced ovarian tumor burden and the circulating tumor antigen, CA125, to undetectable levels. Taken together, these studies demonstrate the importance of cross-talk between steroid hormone action and the anticipatory UPR pathway in the development of hormone-dependent cancer. We show that targeting anticipatory UPR signaling is a promising new way to attack therapy-resistant cancers. Moreover, estrogens are known to have significant effects in neurodegenerative diseases, metabolic syndrome, and diabetes. Our studies of the anticipatory UPR pathway stimulated by steroid hormones in cancer cells open the way for further studies of the role of the estrogen-activated anticipatory UPR pathway in the pathology of these diverse disease states

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells

Involvement of CCL2 and CH25H Genes and TNF signaling pathways in mast cell activation and pathogenesis of chronic spontaneous urticaria

Chronic spontaneous urticaria (CSU), a mast cell-driven disease, substantially affects the quality of life. While genetics affect CSU susceptibility and severity, the specific genetic factors associated with mast cell activation in CSU remain elusive. We aimed to identify key genetic factors and investigate their roles in CSU pathogenesis. Two gene expression datasets from the Gene Expression Omnibus were merged and validated using principal component analysis and boxplots. The merged dataset was subjected to limma and weighted gene co-expression network analyses. Genes whose expression correlated highly with CSU were identified and analyzed using Gene Set Enrichment Analysis (GSEA), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. As GSEA, GO, and KEGG analyses highlighted the importance of chemokine (C-C motif) ligand 2 (CCL2) and cholesterol 25-hydroxylase (CH25H) gene and tumor necrosis factor (TNF) signaling pathways in CSU; the three corresponding genes were knocked down in human mast cell line-1 (HMC-1), followed by incubation with thrombin to mimic CSU pathogenesis. CCL2, CH25H, and TNF knockdown reduced excitability and cytokine production in HMC-1. Our findings suggest that genes involved in the CCL2, CH25H, and TNF pathways play crucial roles in CSU pathogenesis, providing insights into potential therapeutic targets for CSU treatment

Computational evaluation of TIS annotation for prokaryotic genomes

<p>Abstract</p> <p>Background</p> <p>Accurate annotation of translation initiation sites (TISs) is essential for understanding the translation initiation mechanism. However, the reliability of TIS annotation in widely used databases such as RefSeq is uncertain due to the lack of experimental benchmarks.</p> <p>Results</p> <p>Based on a homogeneity assumption that gene translation-related signals are uniformly distributed across a genome, we have established a computational method for a large-scale quantitative assessment of the reliability of TIS annotations for any prokaryotic genome. The method consists of modeling a positional weight matrix (PWM) of aligned sequences around predicted TISs in terms of a linear combination of three elementary PWMs, one for true TIS and the two others for false TISs. The three elementary PWMs are obtained using a reference set with highly reliable TIS predictions. A generalized least square estimator determines the weighting of the true TIS in the observed PWM, from which the accuracy of the prediction is derived. The validity of the method and the extent of the limitation of the assumptions are explicitly addressed by testing on experimentally verified TISs with variable accuracy of the reference sets. The method is applied to estimate the accuracy of TIS annotations that are provided on public databases such as RefSeq and ProTISA and by programs such as EasyGene, GeneMarkS, Glimmer 3 and TiCo. It is shown that RefSeq's TIS prediction is significantly less accurate than two recent predictors, Tico and ProTISA. With convincing proofs, we show two general preferential biases in the RefSeq annotation, <it>i.e</it>. over-annotating the longest open reading frame (LORF) and under-annotating ATG start codon. Finally, we have established a new TIS database, SupTISA, based on the best prediction of all the predictors; SupTISA has achieved an average accuracy of 92% over all 532 complete genomes.</p> <p>Conclusion</p> <p>Large-scale computational evaluation of TIS annotation has been achieved. A new TIS database much better than RefSeq has been constructed, and it provides a valuable resource for further TIS studies.</p

Effect of far-infrared therapy device on arteriovenous fistula maturation and lifespan in hemodialysis patients: a randomized controlled clinical trial

IntroductionArteriovenous fistula (AVF) is the first choice of vascular access for hemodialysis treatment, and its surgical maturity rate is not high, and its postoperative complications (mostly stenosis) significantly shorten its life. At present, there are few studies on treatment methods to improve the maturity and survival of AVF. In this study, the effect of far infrared therapy (FIR) on the maturity and longevity of arteriovenous fistula in hemodialysis patients was discussed, and the protective mechanism of AVF induced by FIR therapy was explored, aiming at exploring a new treatment method.MethodsThe hemodialysis patients admitted to the 900th Hospital of the Chinese Joint Logistics Support Force of the People's Liberation Army from January 2021 to April 2023 were randomly divided into control group and intervention group, with 40 cases in each group. Among them, the control group was coated with mucopolysaccharide polysulfonate cream; Intervention group: The patients were treated with mucopolysaccharide polysulfonate cream and far infrared radiation at the same time. After 3 months' intervention, the arteriovenous fistula (vein diameter, mature time of arteriovenous fistula, blood flow controlled by pump during dialysis, blood flow of brachial artery during dialysis and the occurrence of complications of internal fistula (oozing, occlusion and infection) and the pain score (numerical rating scale, NRS) of the two groups were compared, and the curative effects were compared.ResultsThere was no significant difference in general data between the two groups (P &gt; 0.05), which indicated that the study was comparable. After 3 months' intervention, the vein diameter, pump-controlled blood flow and brachial artery blood flow in the intervention group were significantly higher than those in the control group (P &lt; 0.05). And the maturity time, NRS score and complication rate of arteriovenous fistula were significantly lower than those of the control group (P &lt; 0.05). The primary patency rate of AVF in the intervention group was higher than that in the control group, and the overall patency rate between the two groups was statistically significant (P &lt; 0.05).ConclusionsAs a promising new treatment method, far infrared therapy can effectively promote the maturity of AVF, increase venous diameter, pump controlled blood flow during dialysis, brachial artery blood flow during dialysis, and prolong the service life of AVF